Genética, Citologia e Bioquímica(UFSM 2013) Ácidos nucleicos

Moderador: [ Moderadores TTB ]

Avatar do usuário
Autor do Tópico
danimedrado
Guru
Mensagens: 393
Registrado em: Qui 02 Mar, 2017 12:08
Última visita: 22-05-19
Agradeceu: 173
Agradeceram: 8
Set 2018 29 11:52

(UFSM 2013) Ácidos nucleicos

Mensagem não lida por danimedrado » Sáb 29 Set, 2018 11:52

O problema da desnutrição é mundial. Um pesquisador conseguiu uma nova variedade de feijão muito mais nutritiva. Para isso, ele precisou alterar o DNA responsável pela informação necessária à síntese da proteína faseolina. A seguir, estão representados, respectivamente, parte da sequência de códons e eles mesmos, após a mutação obtida.
[tex3]\frac{CCUAAGGGACCAGGUUUCAGACAU}{GCUAAGGGACCAGGUUUCAGACAU}[/tex3]
Informe qual a fita de DNA deu origem à sequência mutante.
a. GGATTCCCTGGTCCAAAGTCTGTA
b. CGATTCCCTGGTCCAAAGTCTGTA
c. CGAUUCCCUGGUCCAAAGCUGUA
d. GGAUUCCCUGGUCCAAAGUCUGUA
e. ATGTCTGAAAACCTGGTCCCTTAGC
Resposta

B
Alguém poderia me auxiliar nessa questão?




Avatar do usuário
newage
iniciante
Mensagens: 5
Registrado em: Sáb 29 Set, 2018 10:16
Última visita: 12-10-18
Agradeceram: 3
Set 2018 29 12:25

Re: (UFSM 2013) Ácidos nucleicos

Mensagem não lida por newage » Sáb 29 Set, 2018 12:25

Bom dia, o exercício pede para você encontrar a fita de DNA que deu origem à sequência mutante. Nesse caso você deve transpor a sequência de DNA mutante, seguindo a correspondência:

Uracila (U) -> Adenina (A)
Adenina (A) -> Timina (T)
Citosina (C) -> Guanina (G)
Guanina (G) -> Citosina (C)

Transpondo o código genético mutante GCUAAGGGACCAGGUUUCAGACAU, tem-se:

CGATTCCCTGGTCCAAAGTCTGTA, que corresponde à letra B.

Última edição: newage (Sáb 29 Set, 2018 12:25). Total de 1 vez.


Atenciosamente.

Responder
  • Tópicos Semelhantes
    Respostas
    Exibições
    Última msg

Voltar para “Genética, Citologia e Bioquímica”